Elewacja białka wiążącego RNA CUGBP1 jest wczesnym zdarzeniem w indukowalnym, specyficznym dla serca modelu mysiej dystrofii miotonicznej ad 9

Aby zbadać składanie endogennego Tnnt2, użyto całkowitego RNA (5 | jg) i 100 ng startera oligo (dT) do syntezy pierwszej nici cDNA. Amplifikację PCR przeprowadzono za pomocą starterów, jak opisano wcześniej (46, 47). Aby wykryć mRNA endogennego FXR1h, zastosowano 1-etapową RT-PCR zawierającą całkowite RNA (1 | ig), 1,5 mM MgCl2, 0,2 mM dNTP, 2,8 U AMV odwrotnej transkryptazy (Life Science), 0,4 U Platyny Taq (Invitrogen), 200 ng do przodu (GATAATACAGAATCCGATCAG) i odwrotne (CTGAAGGACCATGCTCTTCAATCAC) startery i 1,5 ng primera znakowanego 5 (3-P-end. Te startery generują 4 fragmenty (195, 276, 287 i 368 bp). Odwrotną transkrypcję przeprowadzono w temperaturze 42 ° C przez godzinę, a następnie 20 cykli amplifikacji PCR składającej się z 45 sekund w 95 ° C, 45 sekund w 57 ° C i 45 sekund w 72 ° C i końcowego 10-minutowego wydłużenia przy 72 ° C. Continue reading „Elewacja białka wiążącego RNA CUGBP1 jest wczesnym zdarzeniem w indukowalnym, specyficznym dla serca modelu mysiej dystrofii miotonicznej ad 9”

GSK-3 jest centralnym regulatorem patologii związanych z wiekiem u myszy ad 7

Obserwowaliśmy znaczny wzrost ROS w sercu i mięśniach szkieletowych myszy KO, a to może sprzyjać starzeniu. Powiedział, że nie jest jasne, jak skreślenie GSK-3. może doprowadzić do zwiększenia produkcji ROS, a określenie mechanizmu wykracza poza zakres tej pracy. Dysponujemy jednak danymi mechanistycznymi dotyczącymi rozregulowania dwóch kluczowych ścieżek, z których obie znacząco rzutują na autofagię. Inaktywacja mutacji w białkach IRS, centralnych komponentach szlaku sygnałowego insuliny / IGF-1, przedłuża okres życia u różnych gatunków. Continue reading „GSK-3 jest centralnym regulatorem patologii związanych z wiekiem u myszy ad 7”

Obrazowanie PET makrofagów mózgu za pomocą obwodowego receptora benzodiazepinowego w modelu makaka neuroAIDS ad 6

Nie zaobserwowano znaczącej różnicy w móżdżku (CB) i korze potylicznej (OC). Dane analizowano przy użyciu jednostronnej ANOVA. * P <0,004, ** P <0,0002. (B) Doświadczenia wiązania [3H] (R) -PK11195 (0,5-80 nM) wiązania nasycenia wskazują, że wzrost wiązania specyficznego jest spowodowany wzrostem całkowitej liczby miejsc wiążących [3H] (R) -PK11195 (3 (Bmax, femtomole). na miligram białka, oś y) w SIVE (n = 3, czarne słupki) w porównaniu z niezakażonymi kontrolami (Con; n = 2, białe słupki) i zakażonymi SIV, nonencefalitycznymi (SIV; n = 3, kreskowane kreski) przednie kora mózgowa. Continue reading „Obrazowanie PET makrofagów mózgu za pomocą obwodowego receptora benzodiazepinowego w modelu makaka neuroAIDS ad 6”

Wewnątrznosowe leczenie Poly-IC zaostrza gruźlicę u myszy poprzez rekrutację płucną populacji monocytów / makrofagów dopuszczających patogeny czesc 4

Przedstawione dane reprezentują 3 niezależne eksperymenty. (A i C) Liczby w obrębie lub obok każdego pola odnoszą się do częstotliwości komórek w każdej bramce. Aby potwierdzić, że obserwowane zmiany w przedziale mieloidowym płuc wynikają z indukcji IFN typu I przez Poly-ICLC, powyższe doświadczenia przeprowadzono u myszy z niedoborem Ifnabr. W bezpośrednim przeciwieństwie do wyników obserwowanych u myszy WT, nie obserwowano wzrostu częstotliwości i bezwzględnej liczby komórek CDllb + Gr1int, gdy zwierzęta, niezdolne do sygnalizowania IFN typu I, były zakażone i leczone lekiem (Figura 5, A i B). W tych samych eksperymentach zaobserwowaliśmy, że traktowanie Poly-ICLC indukowało znaczny spadek częstotliwości monocytów / makrofagów wyrażających MHC klasy IIp (komórki F4 / 80 +), czego nie obserwowano u zarażonych myszy z niedoborem Ifnabr leczonych lekiem (Figura 5, A i B). Continue reading „Wewnątrznosowe leczenie Poly-IC zaostrza gruźlicę u myszy poprzez rekrutację płucną populacji monocytów / makrofagów dopuszczających patogeny czesc 4”

Gas1 jest modyfikatorem holoprosencephaly i genetycznie współdziała z dźwiękowym jeżem ad

Gli1 jest jedynym aktywatorem i specyficznym celem transdukcji Shh, ale odgrywa rolę drugorzędną w sygnalizacji (23, 25). Dokładne zdarzenia, które pośredniczą w odbiorze Shh na powierzchni komórek odbiorczych, nie są w pełni zrozumiałe. Jednakże zidentyfikowano kilka białek związanych z błoną plazmatyczną, które mogą wiązać Shh i regulować aktywność szlaku u kręgowców. Należą do nich Megalin, receptor lipoproteinowy o małej gęstości (26), białka z domenami transbłonowymi powtórzeń Ig / fibronektyna III Cdo i Boc (27, 28) oraz białko interferujące z błoną glikoproteinową (29, 30) i zatrzymanie wzrostu. specyficzny (Gaz 1, odnośnik 31). Continue reading „Gas1 jest modyfikatorem holoprosencephaly i genetycznie współdziała z dźwiękowym jeżem ad”

Patogenna Escherichia coli zwiększa Cl wydzielanie z nabłonka jelitowego przez zwiększenie ekspresji receptora galaniny-1 ad

Chociaż komórki nabłonkowe wyściełające okrężnicę mysią normalnie nie eksprymują Gal1-R, pomimo ciągłego kontaktu z normalną florą okrężnicy, zakażenie EHEC aktywuje NF-kB i powoduje ekspresję nowego Gal1-R de novo. Okrężnice myszy zainfekowanych EHEC zwiększają prąd zwarciowy (Isc) w odpowiedzi na galaninę, gdy są oceniane w komorze Ussinga. Ogólnie, obserwacje te wskazują, że zmiany w ekspresji Gal1-R indukowane przez enterogenu odpowiadają nowatorskiej ścieżce jednoczącej, stanowiącej znaczną część nadmiernego wydzielania płynu związanego z zakaźną biegunką. Metody Odczynniki. Bakterie chorobotwórcze (EHEC, EPEC, ETEC) zostały hojnie dostarczone przez J. Continue reading „Patogenna Escherichia coli zwiększa Cl wydzielanie z nabłonka jelitowego przez zwiększenie ekspresji receptora galaniny-1 ad”

Patogenna Escherichia coli zwiększa Cl wydzielanie z nabłonka jelitowego przez zwiększenie ekspresji receptora galaniny-1 ad 9

Aktywacja NF-pB prowadzi do zwiększenia ilości mRNA Gal1-R i syntezy białka, ostatecznie prowadząc do zwiększenia Cl. wydzielanie. Ponieważ normalne komensalne E. coli wydają się hamować aktywację NF-kB (Figura 1a), i nie działają w celu zwiększenia transkrypcji lub translacji Gal1-R, zmiany w translacji i transkrypcji tego białka są specyficzne dla zakażenia patogenami jelitowymi. To, że te efekty nie są unikalne dla komórek T84, zostało pokazane w naszych mysich eksperymentach. Continue reading „Patogenna Escherichia coli zwiększa Cl wydzielanie z nabłonka jelitowego przez zwiększenie ekspresji receptora galaniny-1 ad 9”

Podzbiór neutrofilów w ludzkim ogólnoustrojowym zapaleniu hamuje odpowiedź komórek T poprzez Mac-1 ad 7

Hipotezę tę potwierdza fakt, że zapalenie wywołuje stres immunologiczny, a jego mediatory, takie jak glukokortykoidy i katecholaminy, mogą mobilizować dojrzałe neutrofile (32). Wydaje się, że nie jest możliwe naśladowanie takich instrukcji i dojrzewania w tkankach in vitro, ponieważ neutrofile ex vivo ulegają szybkiej apoptozie w ciągu 24 godzin. Natomiast in vivo okres półtrwania krążących neutrofili jest znacznie dłuższy (około 3,75 dni), a okres półtrwania w tkankach neutrofilowych jest szacowany na 6- do 15-krotnie dłuższy niż w krążących neutrofilach (33, 34). ). Neutrofile uwalniane po ogólnoustrojowej prowokacji LPS wykazywały właściwości regulacyjne. Continue reading „Podzbiór neutrofilów w ludzkim ogólnoustrojowym zapaleniu hamuje odpowiedź komórek T poprzez Mac-1 ad 7”

Dominująco odziedziczył hiperinsulinizm wywołany mutacją receptora sulfonylomocznika typu 1 ad 6

Ojcowie siedmiu pacjentów byli niepowiązani i żaden z nich nie nosił mutacji. Haplotypy odziedziczone po ojcowsku były bardzo różne (ryc. 2). Wszystkie z wyjątkiem jednej z matek (matka przypadków 2 i 3, generacja II) miały upośledzoną tolerancję glukozy lub cukrzycę podczas ciąży. Jeden z nich był leczony insuliną, a cztery miały wartości patologiczne w OGTT. Continue reading „Dominująco odziedziczył hiperinsulinizm wywołany mutacją receptora sulfonylomocznika typu 1 ad 6”

Kluczowa rola kaspazy-3 w osteogennym różnicowaniu zrębowych komórek macierzystych szpiku kostnego czesc 4

Traktowaliśmy BMSSC z TGF-. i badali odpowiednio replikacyjne starzenie i apoptozę. Zaobserwowaliśmy, że TGF-. indukował przyspieszone replikacyjne starzenie w Casp3. /. Continue reading „Kluczowa rola kaspazy-3 w osteogennym różnicowaniu zrębowych komórek macierzystych szpiku kostnego czesc 4”