Elewacja białka wiążącego RNA CUGBP1 jest wczesnym zdarzeniem w indukowalnym, specyficznym dla serca modelu mysiej dystrofii miotonicznej ad 9

Aby zbadać składanie endogennego Tnnt2, użyto całkowitego RNA (5 | jg) i 100 ng startera oligo (dT) do syntezy pierwszej nici cDNA. Amplifikację PCR przeprowadzono za pomocą starterów, jak opisano wcześniej (46, 47). Aby wykryć mRNA endogennego FXR1h, zastosowano 1-etapową RT-PCR zawierającą całkowite RNA (1 | ig), 1,5 mM MgCl2, 0,2 mM dNTP, 2,8 U AMV odwrotnej transkryptazy (Life Science), 0,4 U Platyny Taq (Invitrogen), 200 ng do przodu (GATAATACAGAATCCGATCAG) i odwrotne (CTGAAGGACCATGCTCTTCAATCAC) startery i 1,5 ng primera znakowanego 5 (3-P-end. Te startery generują 4 fragmenty (195, 276, 287 i 368 bp). Odwrotną transkrypcję przeprowadzono w temperaturze 42 ° C przez godzinę, a następnie 20 cykli amplifikacji PCR składającej się z 45 sekund w 95 ° C, 45 sekund w 57 ° C i 45 sekund w 72 ° C i końcowego 10-minutowego wydłużenia przy 72 ° C. Produkty amplifikacji PCR rozdzielono na 5% nieodcuszających żelach poliakrylamidowych. Radioaktywność związaną z każdym pasmem określono ilościowo za pomocą PhosphorImager (Molecular Dynamics). Próbki pacjentów. Próbki ludzkich tkanek uzyskano ze spółdzielni tkankowych, w tym University of Miami Tissue Bank i NDRI, a także z C. Thornton (University of Rochester, Rochester, New York, USA). Fluorescencyjna hybrydyzacja in situ i immunofluorescencja. Fluorescencyjną hybrydyzację in situ przeprowadzono na zamrożonych skrawkach (7 um) przy użyciu (CAG) 5-Cy3. lub (CTG) 5-cio3 znakowanych sond PNA (Applied Biosystems) jak opisano wcześniej (48). Tkanki serca utrwalono w 4% paraformaldehydzie przez 1-2 dni, następnie moczono w 30% sacharozie przez 24-48 godzin w przypadku mrożonego cięcia. Po hybrydyzacji i przemyciu x SSC, skrawki inkubowano z blokującym roztworem (3% BSA i 0,2% Triton X-100 w x PBS) przez godzinę, inkubowano z pierwszorzędowymi przeciwciałami [poliklonalnym anty-MBNL1 przy 1: 1000 lub monoklonalnym anty-CUGBP1 (3B1) przy 2 ug / ml; Abcam; lub monoklonalne antyCUGBP2 (1H2) przy 3 ug / ml] przez 3648 godzin, przemyte PBS, a następnie inkubowane z drugorzędowymi przeciwciałami (Alexa Fluor 488 kozie anty-królicze IgG przy 1: 500 lub Alexa Fluor 488 kozie anty-mysz IgG przy 1: 1000) przez 2 godziny, przemyte i zamontowane za pomocą środka do montowania zawierającego DAPI (1,5 mg / ml, wektor). Poliklonalne przeciwciało anty-MBNL1 zostało wytworzone przeciwko regionowi aminokwasów ^ 255 ludzkiego MBNL1 (numer dostępu GenBank NM_207297). Immunoblot. Białko wyekstrahowano homogenizatorem dounce w 10 mM HEPES (pH 7,5), 0,32 M sacharozie, 1% SDS, 5 (3M MG132 i 5 mM EDTA z inhibitorami proteazy. Do analizy Western blot użyto 50. 70. G białka całkowitego. Membrana była inkubowana z monoklonalnym przeciwciałem anty-CUGBP1 (3B1, Upstate) lub CUGBP2 (1H2) skoniugowanym z HRP (24). Ocena funkcji serca. Ultrasonograf 10-MHz Doppler wykonano na myszach EpA960 / MCM i ich myszach MCM z miotu MCM × EpA960 (linia 1323). Ocenę przeprowadzono przed podaniem tamoksyfenu i co drugi dzień po podaniu tamoksyfenu przez 5 dni. Myszy znieczulono 1% gazem izofluranowym w tlenie (49). Telemetria EKG. Telemetrię EKG u myszy bez znieczulenia i bez ograniczenia przeprowadzono zgodnie z wcześniej opublikowanymi metodami (50). Nadajnik (Data Sciences International) z elektrodami podskórnymi znajdował się w konfiguracji ołowiu I. Telemetrię rejestrowano 7 dni po operacji w warunkach początkowych i po wstrzyknięciu 20 mg / kg tamoksyfenu przez 3 kolejne dni. Dane EKG zbierano przez 5 minut co godzinę, w sumie przez 4 tygodnie. Zbieranie danych przeprowadzono przy użyciu oprogramowania Dataquest, a analizy danych w trybie offline przeprowadzono przy użyciu oprogramowania do analizy EKG Physiostat (wersja 3.1, Data Sciences International). Analizy przeprowadzono bez znajomości genotypu. Statystyka. Wszystkie dane są wyrażone jako średnie. SEM. Istotność statystyczną określono przy użyciu niesparowanego testu Studenta. Wartość AP mniejsza niż 0,05 została uznana za znaczącą. Podziękowania Dziękujemy Jeffery Molkentin za dostarczenie nam myszy MHC-MerCreMer i Donnie Bundman, Thuy Pham, Keitha Weisera i Kamrun Quader za ich pomoc techniczną. Dziękujemy Muge Kuyumcu-Martinezowi i Cheng-Chiu Huang za pomocne dyskusje na temat rękopisu. Praca ta była wspierana przez grant NIH R01AR45653, Fundusz Badawczy Łowców i Stowarzyszenie Dystrofii Mięśni (do TA Cooper) oraz dotację NIH R01DA017173 (do M. De Biasi). Przypisy Niestandardowe stosowane skróty: CELF, CUGBP1- i czynnik podobny do ETR-3; CUGBP, białko wiążące CUG; DM1, dystrofia miotoniczna typu 1; MBNL, podobne do mięśni; MCM, MHC-MerCreMer; PNA, peptydowy kwas nukleinowy; 3. UTR, 3. nieprzetłumaczony region. Konflikt interesów: Autorzy zadeklarowali brak konfliktu interesów. Informacje referencyjne: J. Clin. Invest.117: 2802. 2811 (2007). doi: 10.1172 / JCI32308
[więcej w: podstawowe kroki taneczne, najlepsze piosenki dla dzieci, studia ratownik medyczny ]
[przypisy: diohespan forte, ile kalorii ma chleb orkiszowy, seronil ulotka ]