Elewacja białka wiążącego RNA CUGBP1 jest wczesnym zdarzeniem w indukowalnym, specyficznym dla serca modelu mysiej dystrofii miotonicznej ad 8

Nie wyklucza to, że zaburzenia rytmu wynikają z nieprawidłowej regulacji alternatywnego składania genów krytycznych dla prawidłowych właściwości elektrofizjologicznych serca. Wykazano, że kilka genów nieprawidłowo sklasyfikowano w tkankach sercowych DM1, takich jak TNNT2, KCNAB1, Titin i ALP (21), jak również FXR1h, zidentyfikowanych w niniejszym badaniu. Wykazano, że mutacje w dużej liczbie kanałów jonowych powodują rodzinne formy arytmii, a geny te często wyrażają wiele izoform przez alternatywne splicing (43, 44). Wpływ ekspresji EpA960 (R) RNA na czynność serca jest niezależny od arytmii i wskazuje, że RNA z powtórnym CUG wywołuje funkcjonalną wadę w mięśniu sercowym. Pozostaje do ustalenia, czy odzwierciedla to wpływ na alternatywne splicing lub inne funkcje MBNL, CELF lub innych białek. Metody Transgeniczne myszy. Transgeny EpA960 i EpA0 zawierają wszechobecnie wyrażany promotor CMV (45), zmieniony konkatamer miejsca poliadenylacji SV40 (16) i eksonu ludzkiego DMPK 15 zawierającego 960 kopii przerwanych powtórzeń CTG (EpA960) lub 0 powtórzeń (EpA0). Przerwane powtórzenia CTG opisano uprzednio (4) i wytworzono je przez ligację dwuniciowych oligonukleotydów zawierających 20 powtórzeń CTG i nawisów dla miejsc restrykcyjnych Xhol i SalI. Trawienie za pomocą SalI i XhoI wybranych dla konkatamerów head-to-tail. Wynik został przerwany powtórzeniami zawierającymi CTCGA po każdych 20 powtórzeniach CTG. Pronuclei z myszy FVB zastosowano do mikroiniekcji w celu wytworzenia myszy transgenicznych. Zastosowano dwa zestawy starterów do identyfikacji linii, w których zarówno 5. i 3. końce transgenu były nienaruszone. Dla 5. koniec, zastosowano EpA5.3-GGGAGAGTGAAGCAGAACGTG (do przodu) i EpA5.5-CGGGGTCATTAGTTCATAGCC (wsteczny). Dla 3. koniec, zastosowano EpA3.3-CGGGGTCATTAGTTCATAGCC (forward) i EpA3.52-AAGCCGGGCCGTCCGTCTTC (reverse). Myszy transgeniczne MCM wyrażające indukowalny tamoksyfenem MerCreMer pod kontrolą specyficznego względem serca promotora. -MHC otrzymano z J. Molkentin (17). Wszystkie opisane myszy były potomstwem F1 pokoleniowych EpA x MCM i dlatego były hemizygotyczne dla lub obu transgenów. Miotowe myszy transgeniczne, transgeniczne i typu dzikiego stosowano we wszystkich eksperymentach, gdy tylko było to możliwe. Wszystkie eksperymenty przeprowadzono zgodnie z Podręcznikiem NIH dla użytkowania i opieki nad zwierzętami laboratoryjnymi i zatwierdzonym przez Institutional Animal Care and Use Committee of Baylor College of Medicine. Podawanie tamoksyfenu. W celu indukcji rekombinacji za pośrednictwem Cre, myszy bitransgeniczne, hemizygotyczne dla obu transgenów (wiek 2 do 4 miesięcy) były leczone tamoksyfenem (Sigma-Aldrich) raz dziennie przez 5 kolejnych dni w dawce 20 mg / kg / dzień przez dootrzewnowe iniekcja. Większość myszy bitransgenicznych z linii EpA960 / MCM 1323 zmarło krócej niż tydzień po podaniu tamoksyfenu, ale zmniejszając dawkę do 10 mg / kg / d, żywotność myszy można było przedłużyć do 2 tygodni. W badaniu przebiegu w czasie (Figura 6), samcom myszy Epigen9 / MCM 1323 myszy transgenicznych podawano dawkę tamoksyfenu (20 mg / kg). Tkanki sercowe od wszystkich myszy zebrano do ekstrakcji RNA, ekstrakcji białek i zamrożonego cięcia we wskazanych punktach czasowych. W celu zmniejszenia tła wytworzonego z mysiej IgG w barwieniu immunofluorescencyjnym myszy znieczulono i perfundowano przezsercowo za pomocą PBS, a następnie za pomocą 4% paraformaldehydu dla niektórych eksperymentów. Serca następnie utrwalano w 4% paraformaldehydzie przez noc w 4 ° C przed poddaniem zamrożonemu cięciu. RT-PCR w czasie rzeczywistym. Całkowity komórkowy RNA wyekstrahowano za pomocą TRIzolu (Invitrogen) zgodnie z instrukcjami producenta. C-RNA z pierwszej nici syntetyzowano stosując całkowite RNA o masie cząsteczkowej (. 2 (g, 100 ng losowego heksameru, 1,25 mM dNTP i odwrotnej transkryptazy 6 U AMV. EpA16f (GCCCCGGCTCTGACTGA) i EpA191r (TGTGGTATGGCTGATTATGATCCT) zastosowano do PCR w czasie rzeczywistym RNA z nieskojarzonego allelu w linii transgenicznych EpA960 i EpA0 (Figura 1B). EpA16f i EpA125r (ACAGCACAATAACCAGCACGTT) zastosowano do RT-PCR w czasie rzeczywistym w celu ilościowego oznaczenia mRNA z rekombinowanego allelu (Figura 1C). Pary primerów dla 18S RNA zastosowano jako wewnętrzne kontrole (ACCGCAGCTAGGAATAATGGA i GCCTCAGTTCCGAAAACCA). Reakcję PCR przeprowadzono w systemie ABI-Prism 7000 Sequence Detection System z mieszanką główną SYBR-Green PCR (Applied Biosystems). Liczby cykli nierozłączonych lub rekombinowanych alleli zostały znormalizowane najpierw do liczby cykli 18S. Względny poziom ekspresji niereklamowanych i rekombinowanych alleli określono za pomocą wzoru 2. (Numer cyklu, poszczególne linie). (nr cyklu, o najniższym wyrażaniu EpA960 / MCM 1332). Analiza splicingu RT-PCR
[przypisy: przegladarka skierowan na leczenie, jak długo gotować ciecierzycę, menostop ]
[podobne: menostop, len mielony odtłuszczony, multimed okopowa ]